View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_58 (Length: 283)
Name: NF8503_low_58
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 269
Target Start/End: Original strand, 42218845 - 42219096
Alignment:
| Q |
19 |
attttgcatgtgcctttgctggattagcttactgataagggtttctggtaagtatctttatggaatgcatagttattgtgttctagtatagttcaatttc |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
42218845 |
attttgcatatgcctttgctggattagcttactgataagggtttctggtaagtatctttatggaatgcataattattgggttctagtatagttcaatttc |
42218944 |
T |
|
| Q |
119 |
ccctttgatttt-ttgattgattcaaagctcataagactttattttataaaagtattctccatccttcttaaagtaaagatttttctgcaaatagatatc |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42218945 |
ccctttgatttttttgattgattcaaagctcatgagactgtattttatataagtattctccatccttcctaaagtaaagatttttctgcaaatagatatc |
42219044 |
T |
|
| Q |
218 |
ctatcctatcttgctttatattctctaataaattaaatggcaatatgttctt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
42219045 |
ctatcctatcttgctttatattctctaataaattaattggcaatatgatctt |
42219096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University