View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_63 (Length: 268)
Name: NF8503_low_63
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 34648571 - 34648809
Alignment:
| Q |
18 |
accttggactaacagaactatctacaatggcatggttatggcctccaccacaagtgtggttcaccacagtagctactccacctctgttgaacgttgaatt |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
34648571 |
accttggactaacataactatctacaatggcatggttatggcctccaccacaagtgtggttcaccacagtagctactccacctctgttgaacattaaatt |
34648670 |
T |
 |
| Q |
118 |
gagactttatgcccatcgttggatctatgaaatctatggtagaacaggtcatttgcttcaggggcacaaatggaaacattgtttcttcgctagttggaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34648671 |
gagactttatgcccatcgttggatctatgaaatctatggtagaacaggtcatttgcttcaggggcacaaatggaaacattgtttcttcgctagttggaga |
34648770 |
T |
 |
| Q |
218 |
aaaccagaaaaaacatgggccccacgtgattttcttctc |
256 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||||| |
|
|
| T |
34648771 |
gaaccagaaaaaacatgggtctcacgtgattttgttctc |
34648809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University