View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_69 (Length: 255)
Name: NF8503_low_69
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_69 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 32 - 233
Target Start/End: Complemental strand, 10510652 - 10510451
Alignment:
| Q |
32 |
tgttggtggcgttcgttttctttttatcttatattgttttggactttgtattcttgcaccattgctttccctatttgctggcatttcgtctcttcactac |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10510652 |
tgttggtggcgttcgttttctttttatcttatactgttttggactttgtattcttgcaccattgctttccctatttgcaggcatttcgtctcttcactac |
10510553 |
T |
 |
| Q |
132 |
aacaaagatatgtagtttcaagcaaacctattaaaatctggtccttttatttgatttaaaggtcattagttagttattcctctcaattctcaataagtaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10510552 |
aacaaagatatgtagtttcaagcaaacctattaaaatctggtccttttatttgatttaaaggtcattagttagttattcctctcaattctcaataagtaa |
10510453 |
T |
 |
| Q |
232 |
tg |
233 |
Q |
| |
|
|| |
|
|
| T |
10510452 |
tg |
10510451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 7482176 - 7482137
Alignment:
| Q |
1 |
tgtgggtggtggtgatggaagagatcaatgatgttggtgg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7482176 |
tgtgggtggtggtgatggaagagatcaatgatgttggtgg |
7482137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 40
Target Start/End: Complemental strand, 7464074 - 7464039
Alignment:
| Q |
5 |
ggtggtggtgatggaagagatcaatgatgttggtgg |
40 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7464074 |
ggtggtagtgatggaagagatcaatgatgttggtgg |
7464039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University