View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8503_low_78 (Length: 238)
Name: NF8503_low_78
Description: NF8503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8503_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 27 - 222
Target Start/End: Complemental strand, 22326440 - 22326245
Alignment:
| Q |
27 |
taattcccctagttttattattggtaattgggagtttaacttgcttgttacaagttaaaactttattattatttcaaaaagacaagggtggatgtctttg |
126 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22326440 |
taattcacctatttttattattggtaattgggagtttaacttgcttgttacaagttaaaactttattattatttcaaaaagacaagggtggatgtctttg |
22326341 |
T |
 |
| Q |
127 |
ttggagggatagatcctttatatgctaccaccacaccttttgaaagggacaccatcacagcttttttggccttctctctctatctttacccctttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22326340 |
ttggagggatagatcctttatatgctaccaccacaccttttgaaagggacaccatcacagcttttttggccttctctctctatctttacccctttt |
22326245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 34
Target Start/End: Complemental strand, 23976118 - 23976086
Alignment:
| Q |
2 |
ttttccattcgaggactaaagtgactaattccc |
34 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
23976118 |
ttttccattcaaggactaaagtgactaattccc |
23976086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 31912220 - 31912188
Alignment:
| Q |
6 |
ccattcgaggactaaagtgactaattcccctag |
38 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
31912220 |
ccattcaaggactaaagtgactaattcccctag |
31912188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University