View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8504_low_10 (Length: 317)
Name: NF8504_low_10
Description: NF8504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8504_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 7961137 - 7960849
Alignment:
| Q |
20 |
gcaatcacacgacacacgagcattgcccttctagaatcttctccaacagaattgtcatgggccctaccactactagcattggtcttcactccacctttct |
119 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7961137 |
gcaatcacacgacacaccagcattgcccttctagaatcttctccaaccgaattgtcatgggccctaccactactagcattggtcttcactccacctttct |
7961038 |
T |
 |
| Q |
120 |
tttgaaaaccgtggcggatgatgttgcaaactccgcatccaggcacagcgcaaagggtggaggaaccacttgcaccgagtgcacacgataacgatgtgct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7961037 |
tttgaaaaccgtggcggatgatgttgcaaacaccgcatccaggcacagcgcaaagggtggaggaaccacttgcaccgagtgcacacgataacgatgtgct |
7960938 |
T |
 |
| Q |
220 |
gtggaaacggaggagttcattgccgtccgcggcacaccggggatttttcttggtggtgttggatgcacgggattttactgcgtctctgc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7960937 |
gtggaaacggaggagttcattgccgtccgcggcacaccggggatttttcttggtggtgttggatgcacgggattttactgcgtctctgc |
7960849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University