View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8504_low_5 (Length: 464)
Name: NF8504_low_5
Description: NF8504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8504_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 24040590 - 24040828
Alignment:
| Q |
19 |
ggtgtgggatatgaggtggagacgtcgannnnnnnn-gttggaacatgtcttagtggtatagttattggtggtgttggatgtgagatcgttgtcaattgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24040590 |
ggtgtgggatatgaggtggagacgtcaatttttttttgttggaacatgtcttagtggtatagttattggtggtgttggatgtgaagtcgttgtcaattgg |
24040689 |
T |
|
| Q |
118 |
gggttgattattggtcttggaagtttgcttcagatgtagtctactcgacctggtttacgtatgattctctctcggaggaggatttaagggttgtaggtag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24040690 |
gggttgattattggtcttggaagtttgcttcagatgcagtctactcgacctggtttacgtatgattctctctcggaggaggatttaagggttgtaggtag |
24040789 |
T |
|
| Q |
218 |
ggtgacatggttgttccatttgcttgcaaaggtttgaaa |
256 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24040790 |
ggtggcatggttgttccatttgcttgcaaaggtttgaaa |
24040828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 261 - 348
Target Start/End: Original strand, 24040899 - 24040986
Alignment:
| Q |
261 |
tttttctgctaatttcttgtgtcttaatctctttggtggcgttgacttggttaattatttccttagtttgggcacaaggatggaggca |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24040899 |
tttttctgctaatttcttgtgtcttaatctctttggtggcgttgacttggttaattatttccttagtttgggcacaaggatggaggca |
24040986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 423 - 464
Target Start/End: Original strand, 24041061 - 24041102
Alignment:
| Q |
423 |
gggatcttttggtcaccattggtgttccatctatctgtgtac |
464 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24041061 |
gggatcttttggtcaccattggtgttccatctatctgtgtac |
24041102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University