View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_high_25 (Length: 220)
Name: NF8505_high_25
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 15 - 103
Target Start/End: Original strand, 14754579 - 14754667
Alignment:
| Q |
15 |
tttggtggttctacatgttcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
103 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754579 |
tttggtggttctacttgttcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
14754667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University