View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_18 (Length: 318)
Name: NF8505_low_18
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 13 - 150
Target Start/End: Complemental strand, 3123505 - 3123371
Alignment:
| Q |
13 |
gatgagtttgacataggtagagttccacttctatcaaatagcaagactcctttgttgaaggtctcgcacgtggtagatagataggaatcaaaaataagga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||| |||| ||||||||| | |||| || |
|
|
| T |
3123505 |
gatgagtttgacataggtagagttccacttccatcaaatagcaagactcctttgttgaaggtctcaaatgtgataga---gtaggaatcagacataatga |
3123409 |
T |
|
| Q |
113 |
ttcttgaagatgtagatgataaatacagttgtagttga |
150 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
3123408 |
ttcttgaagatgtaaatgataaatatagttgtagttga |
3123371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University