View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_19 (Length: 317)
Name: NF8505_low_19
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 5925674 - 5925953
Alignment:
| Q |
18 |
ataaatatcaatacctaaattaatagtcaatagactaatctctaacttttcgtgtaagtgacacacaattnnnnnnnnnnn-gtatttatttataaatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5925674 |
ataaatatcaatacctaaattaatagtcaatagactagtctctaacttttcgtgtaagtgacacacaatttaaaaaaaaaatgtatttatttataaatat |
5925773 |
T |
 |
| Q |
117 |
gatatgattggtctaaagcaaaggattgagttagatcnnnnnnncaacaccaaaatatcatgaatgcatcatgcatgtgtcttgtacttgtacatgagaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5925774 |
gatatgattggtctaaagcaaaggattgagttagatctttttttcaacaccaaaatatcatgaatgc-------atgtgtcttgtacttgtacatgagaa |
5925866 |
T |
 |
| Q |
217 |
gtaacacgtcaaacacttattgcatgtattatactatcattcaagtatatagttatggaggtgtggatccctactcttggtgttgtct |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5925867 |
gtaacacgtcaaacacttattgcatgtattatactatcaat-aagtatatagttatggaggtgtggatccctactcttggtgttgtct |
5925953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University