View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_28 (Length: 260)
Name: NF8505_low_28
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 32560355 - 32560123
Alignment:
| Q |
12 |
aatccccaaacaatttgaggaacctccaaaaacttttgttgttgaacaacaaaaccatatgatgaaacattcttgctcataaatacaaggttttgaggta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560355 |
aatccccaaacaatttgaggaacctccaaaaacttttgttgttgaacaacaaaaccatatgatgaaacattcttgctcataaatacaaggttttgaggta |
32560256 |
T |
|
| Q |
112 |
gcaaaaatgctcttagaatcaaaacagcaataaacnnnnnnncaatcttgcaaactaatgaatttaggttgccaccacccattaacttaatcagcttgca |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560255 |
gcaaaaatgctcttagaatcaaaacagcaataaacaaaaaaacaatcttgcaaactaatgaatttaggttgccaccacccattaacttaatcagcttgca |
32560156 |
T |
|
| Q |
212 |
attaaacaagaattccataaatataattgttta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32560155 |
attaaacaagaattccataaatataattgttta |
32560123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University