View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_33 (Length: 240)
Name: NF8505_low_33
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 108 - 222
Target Start/End: Original strand, 3123645 - 3123759
Alignment:
| Q |
108 |
caattttctagaataattaaaatttaacaaaaaagtaagggaatgaaacacgtacgttccaaaatgcagtgcatcaccaagaaatattgcactaaaagat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3123645 |
caattttctagaataattaaaatttaacaaaaaagtaagggaatgaaattcgtacgttccaaaatgcagtgcatcaccaagaaatatagcactaaaagat |
3123744 |
T |
 |
| Q |
208 |
gcagcaatagctatt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3123745 |
gcagcaatagctatt |
3123759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 3123565 - 3123643
Alignment:
| Q |
1 |
ctgctccaactacactgcaaacatttgaaaaatgaattgcatatgttaaaagtacacataataaaatactttaaatgag |
79 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||| |||||||| |
|
|
| T |
3123565 |
ctgctccaacaacactgcaaacatttgaaaaatgaattgcatttgttaaaaatgcacataataaaatacactaaatgag |
3123643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University