View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_34 (Length: 238)
Name: NF8505_low_34
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 199867 - 199941
Alignment:
| Q |
1 |
ttatattggaaatttcaaacattttagtgattaaaatttaaaagaagtgagcaatttatcatccgttgttgacat |
75 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
199867 |
ttatatttgaaatttcaaacattttagtgattaaaatttaaaagaagtgagcaatttaacatccgttgttgacat |
199941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University