View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8505_low_37 (Length: 222)
Name: NF8505_low_37
Description: NF8505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8505_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 59 - 181
Target Start/End: Complemental strand, 26583183 - 26583062
Alignment:
| Q |
59 |
ggatttactaaagttagtgttctaagaaaatttcttaatgtactctattaatatcaaaacattttcccttctcatcctctctctct--acccgagcctca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26583183 |
ggatttactaaagttagtgttctaagaaaatttcttaatgtactcta---atatcaaaacattttcccttctcatcctctctctctctacccgagcctca |
26583087 |
T |
|
| Q |
157 |
ctatctcttctctcaccttcatcaa |
181 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26583086 |
ctatctcttctctcaccttcatcaa |
26583062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University