View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8506_high_21 (Length: 220)
Name: NF8506_high_21
Description: NF8506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8506_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 28029143 - 28028938
Alignment:
| Q |
20 |
atttagaccttcattagtttttaactaggcatcccttaattgttcataagagtaatgttccaaaatctattacaataacgagacaaaaagaaggaaaatt |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28029143 |
atttagaccttcattagttttaaactaggcatcccttaattgttcataagagtaatgttccaaa-tctattacaataacgagacaataagaaggaaaatt |
28029045 |
T |
 |
| Q |
120 |
ccatgtcgtttctatttaattttaatcaaaaaattaattaaataatagtttagctagagaga--------gagatggtaacccaaggcttggccatgggc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28029044 |
ccatgtcgtttctatttaattttaatcaaaaaattaattaaataatagtttagcgagagagagagagagagagatggtaacccaaggcttggccatgggc |
28028945 |
T |
 |
| Q |
212 |
agccgcg |
218 |
Q |
| |
|
||||||| |
|
|
| T |
28028944 |
agccgcg |
28028938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University