View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8506_low_19 (Length: 254)
Name: NF8506_low_19
Description: NF8506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8506_low_19 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 49466766 - 49466529
Alignment:
| Q |
18 |
catcactactttattgatatttctatatgagactaaaataaacttttatgatataaaacttacgacttggcagtataaaatcagattcaccatggagttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466766 |
catcactactttattgatatttctatatgagactaaaaaaaacttttatgatataaaacttacgacttggcagtataaaatcagattcaccatggagttt |
49466667 |
T |
|
| Q |
118 |
tacatagtacaggccatgtgcttgatgctaaattaggtgatcaagaaattaagaggactatacaatgcaagcttcactatttcagt-nnnnnnncgaaac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49466666 |
tacatagtacaggccatgtgcttgatgctaaattaggtgatcaagaaattaagaggactatacaatgcaagcttcactatttcagtaaaaaaaacgaaac |
49466567 |
T |
|
| Q |
217 |
aatggtactggcaccagaaatgtggagtatctaaagat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49466566 |
aatggtactggcaccagaaatgtggagtatctaaagat |
49466529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University