View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8507_high_2 (Length: 220)
Name: NF8507_high_2
Description: NF8507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8507_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 21789542 - 21789730
Alignment:
| Q |
18 |
accaatttgaaccagcagtgtgtccaaaacccatttg-ttttaggtgcgtccagaaatagttgttctggcacagcttcgtcatccaacgaagacaaacta |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21789542 |
accaatttgaacccgcagtgtgtccaaaatccatttgattttaggtgcgtccagata-agttgttctggcacagcttcgtcatccaacgaagacaaacta |
21789640 |
T |
|
| Q |
117 |
ttctaataaacttaatcataattgtagtattgaaaatcattgtgataactttattttttaggataatatatcttaatctcttgttatttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21789641 |
ttctaataaacttaatcataattgtagtattgaaaatcattgtgataactttattttttaggataatatatcttaatctcttgttatttt |
21789730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University