View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8507_low_6 (Length: 241)
Name: NF8507_low_6
Description: NF8507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8507_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 139 - 224
Target Start/End: Complemental strand, 46760925 - 46760840
Alignment:
| Q |
139 |
taatatgtaattctaattgaattttgttgtttgttgctctagaatgatttctttcacgtgcgaagatggatcatatctagagttag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46760925 |
taatatgtaattctaattgaattttgttgtttgttgctctagaatgatttctttcacgtgcgaagatggatcatatctagagttag |
46760840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 112
Target Start/End: Complemental strand, 46760960 - 46760920
Alignment:
| Q |
72 |
cgttgatattaatcaaaaccacctgagtatttattcaatat |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46760960 |
cgttggtattaatcaaaaccacctgagtatttatttaatat |
46760920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University