View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8507_low_7 (Length: 240)
Name: NF8507_low_7
Description: NF8507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8507_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 3354660 - 3354884
Alignment:
| Q |
1 |
gtgaaaatgacaaagtgtaaaatgtgatnnnnnnnntacatgtgtacactttcatacgtgtttccaaacatttggcaagggcaaataagacacgtctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
3354660 |
gtgaaaatgacaaagtgtaaaatgtgataaaaaaaatacatgtgtacactttcatacgtgtttccaaacattttgcaaggacaaataagacacgtctcaa |
3354759 |
T |
|
| Q |
101 |
ccatgcataacaattcaagaatagaagatcatactctccaacggctgaattgcttgtcaaactcattttgagtgattacggatttttcttgaatatcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354760 |
ccatgcataacaattcaagaatagaagatcatactctccaacggctgaattgcttgtcaaactcattttgagtgattacggatttttcttgaatatcact |
3354859 |
T |
|
| Q |
201 |
cacaagaagacaacactgccaacct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3354860 |
cacaagaagacaacactgccaacct |
3354884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University