View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_10 (Length: 403)
Name: NF8508_high_10
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 81 - 302
Target Start/End: Complemental strand, 38374511 - 38374290
Alignment:
| Q |
81 |
gtacaaaaaatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38374511 |
gtacaaaaaatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctat |
38374412 |
T |
 |
| Q |
181 |
gataaaataggaggcaaagaatttcaattaagtctatgttatatattaccggtttgtatcgacccctctcataatatgtnnnnnnntcagattgagagcg |
280 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||| |
|
|
| T |
38374411 |
gataaaataggaggtaaagaatttcaattaagcctatgttatatattaccggtttgtatcgatccctctcataatatgtaaaaaaatcagtttgagagcg |
38374312 |
T |
 |
| Q |
281 |
aatcaatttgcatatcgtgctt |
302 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38374311 |
aatcaatttgcatatcgtgctt |
38374290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 319 - 379
Target Start/End: Complemental strand, 38374253 - 38374193
Alignment:
| Q |
319 |
gttgtcgagcaaatcaatttggtttggttttattagacgcattgtttgatgatttacttta |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38374253 |
gttgtcgagcaaatcaatttggtttggttttattagacgcattgtttgatgatttacttta |
38374193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 101 - 154
Target Start/End: Original strand, 35053196 - 35053249
Alignment:
| Q |
101 |
gaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaa |
154 |
Q |
| |
|
|||||||| |||||||||||||| | | ||||||||||||||| ||||||||| |
|
|
| T |
35053196 |
gaccaaaattgcaaaaaatgtgaaattagaggaccaaaaagttcaattttaaaa |
35053249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 38374860 - 38374819
Alignment:
| Q |
19 |
atgccgacaaaccacgtcgagatgttgtggatgccggatggt |
60 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38374860 |
atgccgacaaaccacgtcgagaaaatgtggatgccggatggt |
38374819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University