View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_14 (Length: 360)
Name: NF8508_high_14
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 9 - 347
Target Start/End: Complemental strand, 29624458 - 29624119
Alignment:
| Q |
9 |
cttcgtcttttcctctttgctttactgatatttcatcctcgtttcaatgaattctatat--tgtggttttgatgaaattggttcccttttattgatgaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
29624458 |
cttcgtcttttcctctttgctttactgatatttcatccttgtttcaatgaattctatatattgtggttttgatgaaattgattcccttttatggatgaaa |
29624359 |
T |
 |
| Q |
107 |
tagaaagttgttcttgatttttgatttattttgttttgatgacagatgagaaattttcaagctttggaaataatagtatcgttgtatgcttgtattacaa |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29624358 |
tagaaagttgttctt-atttttgatttattttgttttgatgacagatgataaattttcaagctttggaaataatagtatcattgtatgcttgtattacaa |
29624260 |
T |
 |
| Q |
207 |
gtttgataaataattaggggaggaagtcattgaaactcttgtgtatgatgttgtcatgggatgcttagttattgtgagacagtagtttcaacatttcttt |
306 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
29624259 |
gtttgataaataattaggggaggaagtaattgaaactcttgtgtatgatgttatcatgggatgcttagttattgtgagacagtagtttcagcgtttcttt |
29624160 |
T |
 |
| Q |
307 |
agggtttgttgcaattgtagtggctttgtttcattctgtct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29624159 |
agggtttgttgcaattgtagtggctttgtttcattctgtct |
29624119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University