View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8508_high_22 (Length: 310)

Name: NF8508_high_22
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8508_high_22
NF8508_high_22
[»] chr8 (3 HSPs)
chr8 (238-296)||(9658970-9659028)
chr8 (127-183)||(9658859-9658915)
chr8 (21-73)||(9658751-9658803)
[»] chr5 (1 HSPs)
chr5 (1-73)||(12877735-12877807)


Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 9658970 - 9659028
Alignment:
238 agtctcatttggcttagttttatcacatttccttattagtcacttaaatatattatatg 296  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9658970 agtctcatttggcttagttttatcacatttccttattagtcacttaaatatattatatg 9659028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 9658859 - 9658915
Alignment:
127 gttagacttccctaaaattgggttcatcaataatgaccttttatcccagatactaac 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9658859 gttagacttccctaaaattgggttcatcaataatgaccttttatcccagatactaac 9658915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 9658751 - 9658803
Alignment:
21 tctccggttcgattatctctggtactagtttaggtgggatagtttaacttctt 73  Q
    ||||||||||||||||||||||||||| ||||| ||||||| |||||||||||    
9658751 tctccggttcgattatctctggtactaatttagatgggataatttaacttctt 9658803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 12877735 - 12877807
Alignment:
1 gagtatgtttttcctcaatgtctccggttcgattatctctggtactagtttaggtgggatagtttaacttctt 73  Q
    |||| ||||| ||||||||||||| ||||||||| |||||||||||| |||||||||| || |||| ||||||    
12877735 gagtgtgtttctcctcaatgtctcaggttcgattctctctggtactaatttaggtgggctaatttagcttctt 12877807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University