View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_22 (Length: 310)
Name: NF8508_high_22
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 9658970 - 9659028
Alignment:
| Q |
238 |
agtctcatttggcttagttttatcacatttccttattagtcacttaaatatattatatg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658970 |
agtctcatttggcttagttttatcacatttccttattagtcacttaaatatattatatg |
9659028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 9658859 - 9658915
Alignment:
| Q |
127 |
gttagacttccctaaaattgggttcatcaataatgaccttttatcccagatactaac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658859 |
gttagacttccctaaaattgggttcatcaataatgaccttttatcccagatactaac |
9658915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 9658751 - 9658803
Alignment:
| Q |
21 |
tctccggttcgattatctctggtactagtttaggtgggatagtttaacttctt |
73 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||| ||||||||||| |
|
|
| T |
9658751 |
tctccggttcgattatctctggtactaatttagatgggataatttaacttctt |
9658803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 12877735 - 12877807
Alignment:
| Q |
1 |
gagtatgtttttcctcaatgtctccggttcgattatctctggtactagtttaggtgggatagtttaacttctt |
73 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||| |||||||||||| |||||||||| || |||| |||||| |
|
|
| T |
12877735 |
gagtgtgtttctcctcaatgtctcaggttcgattctctctggtactaatttaggtgggctaatttagcttctt |
12877807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University