View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_32 (Length: 270)
Name: NF8508_high_32
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 21 - 257
Target Start/End: Complemental strand, 51715024 - 51714789
Alignment:
| Q |
21 |
ttcggcacataaccatcgacagcaaaattttagagtggtgtctgtaatagttaaatgaactatatcaagttaacccttagctatcacttggcagctcaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
51715024 |
ttcggcacataaccatcgacagcaaaatttt-gagtggtgtctgtaatagttaaatgaactatatcaagttcagccttagctatcacttggcagctcaga |
51714926 |
T |
|
| Q |
121 |
tgtgatctgcatatataactatcaaaattagtctatggtcatttcaccaaagattgttgctactccattcaatactaactagccactctgatgagtcata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51714925 |
tgtgatctgcatatataactatcaaaattagtctatggtcatttcaccaaagattgttgctgctccattcaatactaactagccactctgatgagtcata |
51714826 |
T |
|
| Q |
221 |
cccacatgatgcaccactctcatctaatagaataatc |
257 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51714825 |
cccacatgatgcaccactgtcatctaatagaataatc |
51714789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University