View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_38 (Length: 247)
Name: NF8508_high_38
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 51 - 224
Target Start/End: Complemental strand, 3298574 - 3298401
Alignment:
| Q |
51 |
ctatcacatatttactaaccgttccaagaacatctcttttataaaagttacagacaatcatttacaaagaatattatctttactatgaactgaagcctta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3298574 |
ctatcacatatttactaaccgttccaagaacatctcttttataaaagttacagacaatcatttacaaagaatattatctttactatgaactgaagcttta |
3298475 |
T |
 |
| Q |
151 |
tcaagttattgtatataggataattattttgtaatattaacttatttagataaagaaacgttagttttggtcgg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3298474 |
tcaagttattgtatataggataattattttgtaatattaacttattttgataaagaaacgttagttttggtcgg |
3298401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 3298631 - 3298598
Alignment:
| Q |
1 |
aacaaataacatgttttattctatcaaccaaatt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3298631 |
aacaaataacatgttttattctatcaaccaaatt |
3298598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University