View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_40 (Length: 243)
Name: NF8508_high_40
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_40 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 4473843 - 4473946
Alignment:
| Q |
18 |
attaataaaacattcatctaatacaaaattttcatattccatgtgtaataataggatctagctacgatttgtgaaaattaacacattatatgatttggtc |
117 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473843 |
attaataaaacattcatcgaatacttaattttcatattccatgtgtaacaataggatctagctacgatttgtgaaaattaacacattatatgatttggtc |
4473942 |
T |
 |
| Q |
118 |
atat |
121 |
Q |
| |
|
|||| |
|
|
| T |
4473943 |
atat |
4473946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 169 - 243
Target Start/End: Original strand, 4473996 - 4474070
Alignment:
| Q |
169 |
acaaattactaaccttgcaaatagacatgaagtcagagtcagttacactgtctcccagtcccaaatcaggcaaat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473996 |
acaaattactaaccttgcaaatagacatgaagtcagagtcagttacactgtctcccagtcccaaatcaggcaaat |
4474070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 175 - 243
Target Start/End: Original strand, 24571296 - 24571364
Alignment:
| Q |
175 |
tactaaccttgcaaatagacatgaagtcagagtcagttacactgtctcccagtcccaaatcaggcaaat |
243 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
24571296 |
tactaaccttgcaaagtgacataaagtcatgatcactttcactatctcccagtcccaaatcaggcaaat |
24571364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University