View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_43 (Length: 238)
Name: NF8508_high_43
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 56312756 - 56312969
Alignment:
| Q |
11 |
tgaatatattgaaaccgtgtatttgttggttttnnnnnnnntcaaccctagttttaaagagctatattatatattatgcatcttgattttgagtcgtctt |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
56312756 |
tgaatatattgaaaccgtgtctttgttggttttaaaaaaa-tcaaccctagttttaaagagctatattatatattatgcatcttgattttgggtcgtctt |
56312854 |
T |
 |
| Q |
111 |
ttttcagaatccataaatatatagtatacacacgcttgatttccaactaatcatagatccaaagctatagcacaccaaaaca--atagtagctagctgcg |
208 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
56312855 |
tt-tcagaatccataaatatatagtatacacacgcttgatttccatctaatcatagatccaaagctatagcacaccaaaacaatatagtagctagctgcg |
56312953 |
T |
 |
| Q |
209 |
tgaaacttgcagccat |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
56312954 |
tgaaacttgcagccat |
56312969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University