View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_high_53 (Length: 201)
Name: NF8508_high_53
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 56070111 - 56070282
Alignment:
| Q |
17 |
ctgttgtaaggcgcaatggaagacagtggatagctttgggcagccaactgtgttaaggccaatcaaggcttttttcttgtgcacatgaagctgatgctct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56070111 |
ctgttgtaaggcgcaatggaagacagtggatagctttgggcagccaactgtgttaaggccaattaaggcttttttcttgtgcacacgaagctgatgctct |
56070210 |
T |
|
| Q |
117 |
gatgagtggagcctagctctaagcttc---ttcacagctgtggcacaatcatcttgaatttgacttgctttc |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56070211 |
gatgagtggagcctagctctaagcttctaattcacagctgtggcacaatcatcttgaatttgacttgctttc |
56070282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 103 - 174
Target Start/End: Complemental strand, 38397524 - 38397453
Alignment:
| Q |
103 |
gaagctgatgctctgatgagtggagcctagctctaagcttcttcacagctgtggcacaatcatcttgaattt |
174 |
Q |
| |
|
|||||| || ||||||| |||||| | |||| |||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
38397524 |
gaagcttatcctctgataagtggatcatagccctaagcttcttcgcagctgtggcacaatcattttgaattt |
38397453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University