View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8508_low_40 (Length: 309)

Name: NF8508_low_40
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8508_low_40
NF8508_low_40
[»] chr4 (1 HSPs)
chr4 (1-135)||(46823589-46823723)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 46823723 - 46823589
Alignment:
1 agatattcgatcatatgtcagcttcaaaataattggtaattggtttcctagacaatgttaagctggaaattgcatagaaaaatatctcaaaagagataca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46823723 agatattcgatcatatgtcagcttcaaaataattggtaattggtttcctagacaatgttaagctggaaattgcatagaaaaatatctcaaaagagataca 46823624  T
101 tgagggatgacannnnnnngctaatcattttaagc 135  Q
    ||||||||||||       ||||||||||||||||    
46823623 tgagggatgacatttttttgctaatcattttaagc 46823589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University