View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_45 (Length: 290)
Name: NF8508_low_45
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 34275979 - 34276235
Alignment:
| Q |
1 |
gagctaaatgaagattcaactgaaaactttggtgaagctgtacctgtgcttgaatgcactgatactgatattttctttgaagatcttttttcaaacattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275979 |
gagctaaatgaagattcaactgaaaactttggtgaagctgtacctgtgcttgaatgcactgatactgatattttctttgaagatcttttttcaaacattg |
34276078 |
T |
 |
| Q |
101 |
atgatctacaagataggatcgacatgatgcgggatctcatcgattcaatcaggtccaccgatgattcaacttcaagtgttggagaagatatctctgattc |
200 |
Q |
| |
|
| ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34276079 |
acgatctacaagataggatcgacgtgatgcgggatctcatcgactcaatcaggtccaccgatgattcagcttcaagtgttggagaagatatctctgattc |
34276178 |
T |
 |
| Q |
201 |
aaatgagagcacttgcactgacagcaattttgtatgaaattatatgttgaatgctgc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34276179 |
aaatgagagcacttgcactgacagcaattttgtatgaaattatatgttgaatgctgc |
34276235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University