View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_51 (Length: 278)
Name: NF8508_low_51
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 44802797 - 44802582
Alignment:
| Q |
18 |
agaaggtagaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802797 |
agaaggttgaagagagcataaagagtgcacaagagacgtgtgctgatgacccagttagtggagaatgcgtagcagcatgggatgaagtggaggaactcag |
44802698 |
T |
|
| Q |
118 |
tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802697 |
tgctgcagcgagtcatgcaagggataggaagaaggattctgaccccttggaggattactgtaaggataaccctgaaaccgacgagtgcaaaacatttgat |
44802598 |
T |
|
| Q |
218 |
acctgatttattatga |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44802597 |
acctgatttattatga |
44802582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 227 - 260
Target Start/End: Complemental strand, 44802561 - 44802528
Alignment:
| Q |
227 |
attatgagcattgattagtggtactgctgcactt |
260 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
44802561 |
attatgagcattgattaatggtactgctgcactt |
44802528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University