View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_58 (Length: 267)
Name: NF8508_low_58
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_58 |
 | |
|
| [»] scaffold0044 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0044 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 57162 - 57416
Alignment:
| Q |
1 |
cactatcgcagaactttcaaccaatgattaatcactatcactggaccaaaaagctgcttcactacccttggccatattttctaaaatgtaacccctttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57162 |
cactatcgcagaactttcaaccaatgattaatcactatcgctcgaccaaaaagctgcttcactacccttggccatattttctaaaatgtaacccctttta |
57261 |
T |
|
| Q |
101 |
tattatattttgccaactttaccctctccccagatgcacaaattcggacgagattagtctggatgtatacatccataccggatttgtccggatgtatcta |
200 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57262 |
tattatatttggccaattttaccctctcccgagatgcacaaattcggactagattagtctggatgtatacatccataccggatttgtccggatgtatcta |
57361 |
T |
|
| Q |
201 |
gatgcatacatccagaccaatctcatccgcatttaggcatctacaacttcatctc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57362 |
gatgcatacatccagaccaatctcatccgcatttaggcatctacaacttcatctc |
57416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University