View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_63 (Length: 253)
Name: NF8508_low_63
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 7 - 191
Target Start/End: Original strand, 16422314 - 16422498
Alignment:
| Q |
7 |
tttggtgttaatgcggtgttgtttacatttacttatgtttcttcaatgttcacataaattggactgcctagaattttgtcaagctgtgttaccagctgaa |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
16422314 |
tttggtattaatgcggtgttgtttacatttacttatgtttcttcaatgttcacataatttggactggctaggattttgtcaagttctgttaccagctgaa |
16422413 |
T |
|
| Q |
107 |
cgcaatgaggtgaccgtggttgactaccttggatacacatggaagttactcatagatttctgccatgacgatggtctgtcttgca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16422414 |
cgcaatgaggtgaccgtggttgactaccttggatacacatggaagttactcatagatttctgccatgacgatggtctgtcttgca |
16422498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 191 - 249
Target Start/End: Original strand, 16422517 - 16422575
Alignment:
| Q |
191 |
aagcactggctaagccacgcaaatttacttcagggcaagttatcgagtttggtgttacc |
249 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
16422517 |
aagctctggctgagccacgcaaatttacttcagggcaggttatcaagttgggtgttacc |
16422575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University