View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_66 (Length: 247)
Name: NF8508_low_66
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 22 - 234
Target Start/End: Original strand, 37407334 - 37407547
Alignment:
| Q |
22 |
caatgcaat-aaattaattcaataaacgtaggtttttggtggaaagggaatgaatggtgttctgacttatctattcacaaaaacaattagagaataccct |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37407334 |
caatgcaatgaaattaattcaataaacgtaggtttttggtggaaagggaatgaatggtgttctgacttatctattcacaaaaacaattagagaataccct |
37407433 |
T |
 |
| Q |
121 |
cgtggaattacttatagaggtctactggcaaaaatgcatgaagaaattnnnnnnnttaacagaaacagatcattcagttaccgcatcttgcaccgtaaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37407434 |
cgtggaattacttatagaggtctactggcaaaaatgcatgaagaaattaaaaaaattaacagaaacagatcattcagttaccgcatcttgcaccgtaaaa |
37407533 |
T |
 |
| Q |
221 |
ttatcgcacaggtt |
234 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37407534 |
ttatcgcacaggtt |
37407547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University