View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_69 (Length: 242)
Name: NF8508_low_69
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_69 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 37755577 - 37755336
Alignment:
| Q |
1 |
agcagagagagaagagcaacacaaggtttagtccagtaaacaaaatattcctgtgaggtgatctaaactagtgcaaacaatattaatccccaataaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37755577 |
agcagagagagaagagcaacacaaggtttagtccggtaaacaaaatattcctgtgaggtgatctaaactagtgcaaacaatattaatccccaataaccca |
37755478 |
T |
 |
| Q |
101 |
gacaacaccctaactttttaactacaaccagtaattgtgccctttgtcattcttaagacgattgattcaatcatctcttcctctttttggtgctgaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37755477 |
gacaacaccctaactttttaactacaaccagtaattgtgccctttgtcattcttaagacgattgattcaatcatttcttcctctttttggtgctgaattc |
37755378 |
T |
 |
| Q |
201 |
aaactcaaaagtgtatattgcactggaagtgtttgacaaagc |
242 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
37755377 |
aaactcacaggtgtatattgcactggaagtgtttgacaaagc |
37755336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University