View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_73 (Length: 237)
Name: NF8508_low_73
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 20590203 - 20590117
Alignment:
| Q |
1 |
cttttggatttgattctgatggagatttgagggttgttgtgtgagagagatgatcttctcatttgaacgatgttatgactttatata |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20590203 |
cttttggatttgattctgatggagatttgagggttgttgtgtgagagagattatcttctcatttgaacgatgttatgactttatata |
20590117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 107
Target Start/End: Original strand, 26330878 - 26330946
Alignment:
| Q |
39 |
gtgtgagagagatgatcttctcatttgaacgatgttatgactttatataactatgtcttggtgagcaag |
107 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||| | |||||| ||| | || ||||||||||| |||| |
|
|
| T |
26330878 |
gtgtgagagatatgttcttctcatttgaatgatggtgtgacttaatagagctttgtcttggtgaacaag |
26330946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University