View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_75 (Length: 233)
Name: NF8508_low_75
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 14621139 - 14620934
Alignment:
| Q |
1 |
gtctgttacgtgtttgatgaaatgctaatgggaatgtgttgatgtgttgatgaaatggtttcttgttgtttgtagttataaggaacggtttctttcgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14621139 |
gtctgttacgtgtttgatgaaatgctaatgggaatgtgttgatg--------aaatggtttcttgttgtttgtagttataaggaacggtttctttcttcg |
14621048 |
T |
 |
| Q |
101 |
ttgccggctgctcgtcgtgcaagtgctgattttactcgtccggtttttatggctgttgctttttatttatgtgcaaagaaacataaggtacatttgtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14621047 |
ttgccggctgctcgtcgtgcaagtgctgattttactcgtccggtttttatggctgttgctttttatttatgtgcaaagaaacataaggtacatttgtaat |
14620948 |
T |
 |
| Q |
201 |
aatctcaacgtaac |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
14620947 |
aatctcaacgtaac |
14620934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 4 - 205
Target Start/End: Original strand, 17709051 - 17709252
Alignment:
| Q |
4 |
tgttacgtgtttgatgaaatgctaatgggaatgtgttgatgtgttgatgaaatggtttcttgttgtttgtagttataaggaacggtttctttcgtcgttg |
103 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17709051 |
tgttacgtgtttgataaaatgctgatgtgaatgtgttgatgtcttgatgaagtggtttcttgttgtttgtagttataaggaacggtttctttcatcgttg |
17709150 |
T |
 |
| Q |
104 |
ccggctgctcgtcgtgcaagtgctgattttactcgtccggtttttatggctgttgctttttatttatgtgcaaagaaacataaggtacatttgtaataat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17709151 |
ccggctgctcgtcgtgcaagtgctgattttactcgtccggtttttatggctgttgctttttatttatgtgcaaagaaacataaggtacatttgtaataat |
17709250 |
T |
 |
| Q |
204 |
ct |
205 |
Q |
| |
|
|| |
|
|
| T |
17709251 |
ct |
17709252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University