View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8508_low_76 (Length: 232)
Name: NF8508_low_76
Description: NF8508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8508_low_76 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 96 - 232
Target Start/End: Complemental strand, 46823841 - 46823705
Alignment:
| Q |
96 |
agttattaaaatggttttaaatttcatatatcatatggtttcctactttcctacccaaaagaatggatattttcaattagtgaaatggtggatttttaaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
46823841 |
agttattaaaatggttttaaatttcatatatcatatggtttcctactttcctacccaaaagaatggatattttcaattagtgaaatagaggaattttaaa |
46823742 |
T |
 |
| Q |
196 |
aagcacttaggcaagcagagatattcgatcatatgtc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46823741 |
aagcacttaggcaagcagagatattcgatcatatgtc |
46823705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 46823932 - 46823873
Alignment:
| Q |
1 |
ctgggacataacatcatgggcgcgcgtatcagcttctgttcatggggtccatacacaactacta |
64 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46823932 |
ctgggacataaaatcatgggcg----tatcagcttctgttcatggggtccatacacaactacta |
46823873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University