View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_high_15 (Length: 336)
Name: NF8509_high_15
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 31 - 317
Target Start/End: Original strand, 4318391 - 4318677
Alignment:
| Q |
31 |
taatactctttgtagtggtaatatattctatggtatattctctgtctcttttcttcatcatgatttaggtcatttagacgcgctataagattaatcattg |
130 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4318391 |
taatactcttggtagtggtaatctattctatggtatattctttgtctcttttcttcatcatgatttaggtcatttagacgcgctataagattaatcatta |
4318490 |
T |
 |
| Q |
131 |
agtaagttacacgacatttatcnnnnnnnnngttttgtttggattagaccgtcttcaaatgctacgtttggttttgcggttggtcattgtagtcgcacgt |
230 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4318491 |
agtaagctacacgacatttatcttatttttctttttgtttgggttggaccgtcttcaaatgctacgtttgattttgcggttggtcattgtagtcgcacgt |
4318590 |
T |
 |
| Q |
231 |
ttagtgttcgattttttgtgaaacaagaagctagtaatagtagttttacaaaatacgtgtgtctactaggctctttgatgtggaaac |
317 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4318591 |
ttagtgttccattttttgtgaaacaagaagctagtaatagtagttttacaaaagacgtgtgtctactaggctctttgatgtggaaac |
4318677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University