View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_high_4 (Length: 487)
Name: NF8509_high_4
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 6e-72; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 19 - 172
Target Start/End: Original strand, 17907219 - 17907372
Alignment:
| Q |
19 |
ctattggcctctgcaagaggttacgaaaaccgatctaatgaacattagataataagtagatgaattacttgttaaattcattaagaggttcaagaaggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17907219 |
ctattggcctctgcaagaggttacgaaaaccgatctaacgaacattagacaataagtagacgaattacttgctaaattcattaagaggttcaagaaggtt |
17907318 |
T |
|
| Q |
119 |
tttaggaaatgctcgatccaatttcttaacattgaatatatgattaatgacatg |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17907319 |
tttaggaaatgctcgatccaatttcttaacattgaatatatgattaatgacatg |
17907372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 349 - 473
Target Start/End: Original strand, 17913944 - 17914061
Alignment:
| Q |
349 |
aaactttgaaaaccctaatcatatatataccttccttattcgcgcttctctcttactctcttcttcatagcaaattctcccttctcctagttaatccctc |
448 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
17913944 |
aaactttgaaaaccctaatcatata----ccttccttgttcgcgcttctctcttactctcgtc---atagcaaattctcccttctcctagttaatccctc |
17914036 |
T |
|
| Q |
449 |
cgccatgtctcctcagcaacctatc |
473 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
17914037 |
cgccatgtctcctcagcaacctatc |
17914061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 168 - 237
Target Start/End: Original strand, 17910391 - 17910460
Alignment:
| Q |
168 |
acatgcacccacatctaaaagagactggttgggtaagtgtgtcatgatttgaatgaaaaggcttcccaag |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17910391 |
acatgcacccacatctaaaagatactggttgggcaagtgtgttatgatttgaatgaaaaggcttcccaag |
17910460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University