View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_22 (Length: 333)
Name: NF8509_low_22
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 4 - 281
Target Start/End: Complemental strand, 6351385 - 6351108
Alignment:
| Q |
4 |
gcagatagttgagagttgagactggtcgaacattacctgctctttgaatatacaatttaaaaatattatcatttgagaagaattaaaaatttagatcaca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351385 |
gcagatagttgagagttgagactggtcgaacattacttgctctttgaatatacaatttaaaaatattatcatttgagaagaattaaaaatttagatcaca |
6351286 |
T |
 |
| Q |
104 |
ttcagctctgaaaaaacataacaaaaatatagttacagagagagactaaataccaacacttatctttatgctcacctgccttgcttcttgtattccgggg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6351285 |
ttcagctctgaaaaaacataacaaaaatatagttacagagagagactaaataccaacacttatctttatgctcacctgccttgcttcttgtatgccgggg |
6351186 |
T |
 |
| Q |
204 |
ttcttgctttcgatactgctgcctttctaataaatagattagttatccccgttcttgctggcctggttatcttgattt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6351185 |
ttcttgctttcgatactgctgcctttctaataaatagattagttatcccctttcttgctggcctggttatcttgattt |
6351108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University