View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_28 (Length: 276)
Name: NF8509_low_28
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_28 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 58 - 250
Target Start/End: Original strand, 44949080 - 44949272
Alignment:
| Q |
58 |
tcattcagtagtaatcaactcactcagaaatccaaccatttctgataatagacacatgctcctgtagagacaacgccatcgggtgaacaaaagctcattc |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949080 |
tcattcagtagtaatcaactcattcagaaatccaaccatttctgataatagacacatgctcctggagagacaacgccatcgggtgaacaaaagctcattc |
44949179 |
T |
|
| Q |
158 |
gctcacaagaaaaacatggaaaggaagtaaagtagccagatttcttttcccctataactccacccttgcttttgcatatgtaacaagttttgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44949180 |
gctcacaagaaaaacatggaaaggaagtaaagtagccagatttcttttcccctataactccacccttgcttttgcatatgtaacaagttttgc |
44949272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 85 - 250
Target Start/End: Original strand, 6469968 - 6470121
Alignment:
| Q |
85 |
aaatccaaccatttctgataatagacacatgctcctgtagagacaacgccatcgggtgaacaaaagctcattcgctcacaagaaaaacatggaaaggaag |
184 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| | || ||||||||| ||||| | ||||||||||||||| || | |||||||||||||||||||| || |
|
|
| T |
6469968 |
aaatccaaccatttctgaaaatacacacatgttgttggagagacaacaccatccgatgaacaaaagctcatccgttgacaagaaaaacatggaaagggag |
6470067 |
T |
|
| Q |
185 |
taaagtagccagatttcttttcccctataactccacccttgcttttgcatatgtaacaagttttgc |
250 |
Q |
| |
|
| ||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6470068 |
tcgagtcagcagatttctttt------------cacccttgcttttgcatatgtaacaagttttgc |
6470121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 74 - 250
Target Start/End: Complemental strand, 419727 - 419563
Alignment:
| Q |
74 |
aactcactcagaaatccaaccatttctgataatagacacatgctcctgtagagacaacgccatcgggtgaacaaaagctcattcgctcacaagaaaaaca |
173 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||| | || ||||||||| || || | ||||||||||||||| || | |||||||||||| |
|
|
| T |
419727 |
aactcattcaaaaatccaaccatttctgataatagacacatgttgttggagagacaacaccgtctgttgaacaaaagctcatccgttgacaagaaaaaca |
419628 |
T |
|
| Q |
174 |
tggaaaggaagtaaagtagccagatttcttttcccctataactccacccttgcttttgcatatgtaacaagttttgc |
250 |
Q |
| |
|
|||||||| ||| ||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
419627 |
tggaaagggagtcgagtcaacagatttctttt------------cacccttgcttttgcatatgtaacaagttttgc |
419563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University