View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_31 (Length: 263)
Name: NF8509_low_31
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 14 - 263
Target Start/End: Original strand, 39626298 - 39626547
Alignment:
| Q |
14 |
attatactatttaacatggtattcctatgcaaaatgccaatgtgtcaatcactatataattattgcgataaatgattgtgtttgcataacacatttgaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39626298 |
attatactatttaacatggtattcctatgcaaaatgccaatgtgtcaatcactataaaattattgcgataaatgattgtgcttgcataacacatttgaat |
39626397 |
T |
 |
| Q |
114 |
ttcggatgatcaatttcttgcaggtaaaaggtttattaagttggcaaaatctccaatgtcacccccgttggctttcccttttcacattacttcatcgggg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39626398 |
ttcggatgatcaatttcttgcaggtaaaaggtttattaagttggcaaaatctccaatgtcacccccgttggctttcccttttcacattacttcatcgggg |
39626497 |
T |
 |
| Q |
214 |
attgttttacttgacaatgatgggatagagatgaaagggccagaaataag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39626498 |
attgttttacttgacaatgatgggatagagatgaaagggccagaaataag |
39626547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University