View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_33 (Length: 255)
Name: NF8509_low_33
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_33 |
 |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 86 - 175
Target Start/End: Complemental strand, 6131651 - 6131562
Alignment:
| Q |
86 |
taaatgagttttgagcttctaagcgtaacttagttggtagaaatttggggtgagagtaggccagatcgagtcggactttgcttaaatagg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6131651 |
taaatgagttttgagcttctaagcgtaacttagttggtagaaattaggggtgagagtagcccagatcgagtcggactttgcttaaatagg |
6131562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 6131704 - 6131647
Alignment:
| Q |
1 |
tgattaacgaaattttaaaataatctctaaaatttattaaaattttgatcacgtaaat |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131704 |
tgattaacgaaattttaaaataatctctaaaatttattaaaattttgatcacgtaaat |
6131647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 40247041 - 40247078
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40247041 |
cttatgattgttttttcttttaagattttactatctct |
40247078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 6131242 - 6131205
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
6131242 |
cttaggattgttttttcttttaagattttactatctct |
6131205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 25418563 - 25418600
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25418563 |
cttaggattgttttttcttttaagattttactatctct |
25418600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 42786881 - 42786918
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42786881 |
cttatgattgttttttcttttaagattttactatctct |
42786918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 53276042 - 53276074
Alignment:
| Q |
205 |
gattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
53276042 |
gattgttttttcttttaagattttactatctct |
53276074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 200 - 239
Target Start/End: Original strand, 33025694 - 33025733
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctcttc |
239 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
33025694 |
cttatgattgtgttttcttttaagattttactatctcttc |
33025733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 204 - 237
Target Start/End: Complemental strand, 32588963 - 32588930
Alignment:
| Q |
204 |
tgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
32588963 |
tgattgttttttcttttaagattttactctctct |
32588930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 38904 - 38867
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
38904 |
cttaggattgttttttcttttaagattttactatctct |
38867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 229
Target Start/End: Original strand, 9689855 - 9689884
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagatttta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9689855 |
cttatgattgttttttcttttaagatttta |
9689884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 33656049 - 33656012
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33656049 |
cttaggattgttttttcttttaagattttactatctct |
33656012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 24776554 - 24776591
Alignment:
| Q |
200 |
cttatgattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
24776554 |
cttaggattgttttttcttttaagattttactatctct |
24776591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Complemental strand, 26601218 - 26601186
Alignment:
| Q |
205 |
gattgttttttcttttaagattttactgtctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
26601218 |
gattgttttttcttttaagattttactatctct |
26601186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University