View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_37 (Length: 246)
Name: NF8509_low_37
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 91 - 234
Target Start/End: Original strand, 26004402 - 26004545
Alignment:
| Q |
91 |
tgttaggttcggtgcgtgatctccttggacagtggagaatggtgcgcgctgtagtgtttatatctctctttctctgtcttcactaacactgttctttcta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26004402 |
tgttaggttcggtgcgtgatctccttggacagtggagaatggtgcgcgctgtagtgtttatatctctctttctctttcttcactaacactgttctttcta |
26004501 |
T |
 |
| Q |
191 |
cagacacaatcctcggttgtagcgtacaatgtcgtttcttctca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26004502 |
cagacacaatcctcggttgtagcgtacaatgtcgtttcttctca |
26004545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University