View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_39 (Length: 232)
Name: NF8509_low_39
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 6226919 - 6227130
Alignment:
| Q |
17 |
aaactatggctgttggacttagagaagggtggactggttcaagtgtggttgtttatggccacttatttgttgtttctgagctcgagagaatgaagcttaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6226919 |
aaactatggctgttggacttagagaagggtggactggttcaagtgtggttgtttatggccacttatttgttgtttctgagctcgaaagaatgaagcttaa |
6227018 |
T |
|
| Q |
117 |
ggtttataaccaggaagccgattcctgggaagccatagatggctcccctttgcctgagcaaatatgccaaccttttgctgtgaatgcttgtgattgtcaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6227019 |
ggtttataaccaggaagccgattcctgggaagccatagatggctcccctttgcctgagcaaatatgcaaaccttttgctgtgaatgcttgtgattgtcaa |
6227118 |
T |
|
| Q |
217 |
atttatctcgta |
228 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
6227119 |
atttatgtcgta |
6227130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University