View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8509_low_41 (Length: 207)
Name: NF8509_low_41
Description: NF8509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8509_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 32 - 191
Target Start/End: Complemental strand, 6665741 - 6665582
Alignment:
| Q |
32 |
gaactcaattgttactgcaatttaaaactttgatcacatgtactattataggtgctattgttcttcttttgacaatgagcattgacataggacttcaaaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6665741 |
gaactcaattgttactgcaatttaaaactttgatcacatgtactattataggtgctattgttcttcttttgacaatgaacattgacataggacttcaaaa |
6665642 |
T |
 |
| Q |
132 |
agaggaaaagaatagcaacattcaaaacagaattgaaaacccaagctccaattccgttac |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6665641 |
agaggaaaagaatagcagcattcaaaacagaattgaaaacccaagctccaattccgttac |
6665582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 150 - 191
Target Start/End: Complemental strand, 7297245 - 7297204
Alignment:
| Q |
150 |
cattcaaaacagaattgaaaacccaagctccaattccgttac |
191 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
7297245 |
cattcaaaatagaattgaaaacccaagcaccaattccattac |
7297204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University