View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_16 (Length: 351)
Name: NF8510_low_16
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 39887519 - 39887826
Alignment:
| Q |
1 |
agggagtagcaccgtcgtatgactatgattggcagattgagtgatgacactcacctcactcatttccagcttaaacatcatgaatgaccagaccagcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39887519 |
agggagtagcaccgtcgtatgactatgattggcagat-gagtgatgacactcacctcactcatttccagcttaaacatcatgaatgaccag-----catg |
39887612 |
T |
 |
| Q |
101 |
gtgtagttgtacgtagtagtatgagttacattctaccacattaattaattaattaattactactacattgtttttatcaatctacgcgcaatgttgtcag |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39887613 |
gtgta------cgtagtagtatgagttacattctaccacattaattaatta--------ctactacattgtttttatcaatctacgcgcaatgttgtcag |
39887698 |
T |
 |
| Q |
201 |
accctctccactccactccacatgatcatactaatcacttgctacttgccattcatgtgccattagttttcatcctactcattgcccaatcatttctttg |
300 |
Q |
| |
|
||||||||| |||| | |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39887699 |
accctctcctctcccc-----atgatcatacaaatcacttgctacttgccattcatgtgccatcagttttcatcctactcattgcccaatcatttctttg |
39887793 |
T |
 |
| Q |
301 |
catttattatctatctacttctacccccatact |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39887794 |
catttattatctatctacttctacccccatact |
39887826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University