View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_21 (Length: 334)
Name: NF8510_low_21
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 37996167 - 37996491
Alignment:
| Q |
1 |
atccacaccaaatttcagctgcatgcaccaaattaaacatcttcacctgctagttttcatggttttggctttttgtctcatattacaaaccgtggttccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37996167 |
atccacaccaaatttcagctgcatgcaccaaattaaacatcttcacctgctagttttcatggttttggctttttgtctcatattacaaaccgtggttccg |
37996266 |
T |
|
| Q |
101 |
ttccgtacagtactaaacgattctataatgtaaacaatgcgtgtgcgttgaggataatcacgatatgaagcactaaaataacacaaatttttgcttaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37996267 |
ttccgtacagtactaaacgattctataatgtaaacaatgcgtgtgcgttgaggataatcacgatatgaagcactaaaataacacaaatttttgcttacac |
37996366 |
T |
|
| Q |
201 |
gagcaatgagtaatggcaaaatgcaagttgcgtggtcctacaattacaaggactcatatataacccacaaaaccatgtgccttattctttccaccaacaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
37996367 |
gagcaatgagtaatggcaaaatgcaagttgcgtggtcctacaattacaaggactcatatataacccacaaaaccatgtgccttattctttcaactaacaa |
37996466 |
T |
|
| Q |
301 |
tactagatcacccccacagtctctg |
325 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
37996467 |
tactagatcacccccacagcctctg |
37996491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University