View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_27 (Length: 300)
Name: NF8510_low_27
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 287
Target Start/End: Complemental strand, 36342636 - 36342364
Alignment:
| Q |
15 |
acttagaggtgtcaaagttaagagggtgatggtatttctatgagcatgtgctcaggtagtgttcatttgtccaatctaaacacatgtgcattgttgggag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36342636 |
acttagaggtgtcaaagttaagagggtgatggcatttcaatgagcatgtgctcaggtagtgttcatttgtccaatctgaacacatgtgcattgttgggag |
36342537 |
T |
|
| Q |
115 |
aaagattttatttagaattttcttcatgtttgcagcaaaatttgggttgccatgtttgcattagtgtgtgcagaattcgatgatttgtcaggttggattt |
214 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36342536 |
aaagattttatttaaaattttcttcttgtttgcagcaaaatttgggttgccatatttgcattagtgtgtgcggaattcgatgatttgtcaggttggattt |
36342437 |
T |
|
| Q |
215 |
tcaaaaacatcgtatttttgcgtcttgacttgaataatagttaagagtagttgaatcattgtggcttgatgtc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36342436 |
tcaaaaacatcgtatttttgcgtcttgacttgaataatagttaagagtagttgaatcatattggcttgatgtc |
36342364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University