View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_31 (Length: 269)
Name: NF8510_low_31
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 256
Target Start/End: Complemental strand, 37983042 - 37982807
Alignment:
| Q |
20 |
ctatctgttcctttattggatgataatgttttaagatactctagtttggaacacgggcaaatcaagttatcgatttgtgatgagaagaagagggaaag-- |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37983042 |
ctatctgttcctttattggatgataatgttgtaagatactctagtttggaacacgggcaaatcaagttatcgatttgtgatgagaagaagagggaaagtg |
37982943 |
T |
|
| Q |
118 |
-cgaagtttcatctggagggagattggaatattttgtgaatgttagtccctcctaaagtttgtaatctctagtttcgagtatatggaggagttgtttgtc |
216 |
Q |
| |
|
|||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
37982942 |
aagaagtttcatttgaagggagattgaaatattttgtgaatgttagtccctcctaaagtttgt-atctctagtttcgagtatat---ggagttgtttgtc |
37982847 |
T |
|
| Q |
217 |
cgactcgtcttagattacatgataaatatatttgatgtcc |
256 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37982846 |
tgactcgtcgtagattacatgataaatatattttatgtcc |
37982807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University