View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8510_low_33 (Length: 256)
Name: NF8510_low_33
Description: NF8510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8510_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 125 - 238
Target Start/End: Original strand, 35688436 - 35688549
Alignment:
| Q |
125 |
ggttgagttgccaccaaaagagtgtgacttgttcaatggtaaatgggttttagataacgtgacacatcctttgtataaagaagatgaatgtgaatttctc |
224 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35688436 |
ggttgagttgccaccaaaagattgtgacttgttcaatggtaaatgggttttagataacgtgacacatcctttgtataaagaagatgaatgtgagtttctc |
35688535 |
T |
|
| Q |
225 |
acttctcaagttac |
238 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35688536 |
acttctcaagttac |
35688549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 35688316 - 35688364
Alignment:
| Q |
5 |
tgttgatgatgatgaagattctgatgagccacaagaacgtgttaaggtg |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35688316 |
tgttgatgatgatgaagattctgatgagccacaagaacgtgttaaggtg |
35688364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 165 - 238
Target Start/End: Original strand, 31821570 - 31821643
Alignment:
| Q |
165 |
aaatgggttttagataacgtgacacatcctttgtataaagaagatgaatgtgaatttctcacttctcaagttac |
238 |
Q |
| |
|
||||||||| | ||||| |||||||||||||| || |||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
31821570 |
aaatgggttcttgataatgtgacacatcctttatacaaagaagaacaatgtgaatttcttacttcacaagttac |
31821643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University